ALT SPL MUT DB

Alternative Splicing Mutation Database

Bechtel J M, Rajesh P, Ilikchyan I, Deng Y, Mishra P K, Wang Q, Wu X, Afonin K, Grose W E, Wang Y, Khuder S, and Fedorov A
NOTE: This is the final 1.0 release of the ASMD. All substitution mutations now have a note describing the codon change involved, based on the exon phase according to the EID. Entry 11 was found to describe a substitution in the last position of its exon (so, in a splicing junction) and had to be removed. A deposition form will be forthcoming.
NOTE: Later releases of the ASMD are now available by following this link. It has a much improved interface, many more entries, a true relational database back-end, and a public deposition form. This site is preserved for now, but may disappear in the future. The link to the more permanent home for the 1.0 release is http://mco321125.meduohio.edu/~jbechtel/asmd/1.0/. Please update any bookmarks to reflect the new location.

Formula for calculating splicing effect: SE = (Fm - Fw) / (Fm + Fw)
Fm = Frequency of mutant mRNA isoform
Fw = Frequency of same isoform with wildtype exon
Download ASMD sequence database (FASTA format)
Download ASMD info file (references, notes, etc.)
Official site (additional materials, source code, etc.)
Unofficial site (temporary location of online database)
NOTE: Gene info, including exon number, is taken from the Exon-Intron Database (EID). This exon number may not agree with that in the references.
warning See paper: Shepelev V., Fedorov A. Advances in the Exon-Intron Database (EID). Briefings in Bioinformatics 2006, 7: 178-185. (PDF 111KB)

# /Exon/   /EID ID (gene info)/   /NCBI acc. num/   /References/   /Notes/   SE
<wildtype exon sequence>
<exon sequence with mutation>
1[EXON_8] [EID ID: 5688C_NT_006713] [NM_022875] [References] [Notes] (SE = -1)
GGTTTCAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGA

GGTTTTAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGA
2[EXON_11] [EID ID: 16210A_NT_010783] [NM_016835] [References] [Notes] (SE = +.4)
GTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGT

GTGCAGATAATTAATAAGAAGCTGGATCTCAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGT
3[EXON_11] [EID ID: 16210A_NT_010783] [NM_016835] [References] [Notes] (SE = -1)
GTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGT

GTGCAGATAATTAAT___AAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGT
4[EXON_5] [EID ID: 18703A_NT_011362] [NM_001250] [References] [Notes] (SE = -.6)
CTACAGGGGTTTCTGATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACCCTTGGACAAG

CTACTGGGGTTTCTGATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACCCTTGGACAAG
5[EXON_7] [EID ID: 18653_NT_011362] [NM_000022] [References] [Notes] (SE = -.5)
GAGGCTGTGAAGAGCGGCATTCACCGTACTGTCCACGCCGGGGAGGTGGGCTCGGCCGAAGTAGTAAAAGAG

GAGGCTGTGAAGAGCGGCATTCACCGTACTGTCCACACCGGGGAGGTGGGCTCGGCCGAAGTAGTAAAAGAG
6[EXON_43] [EID ID: 11619A_NT_033899] [NM_000051] [References] [Notes] (SE = -1)
ACTACGAACATATGAACACGAAGCAATGTGGGGCAAAGCCCTAGTAACATATGACCTCGAAACAGCAATCCCCTCATCAACACGCCAGGCAGGAATCATT
CAG

ACTACGAACATATGAACACGAAGCAATGTGGGGCAAAGCCCTAGTAACATATGACCTCAAAACAGCAATCCCCTCATCAACACGCCAGGCAGGAATCATT
CAG
7[EXON_5] [EID ID: 14846_NT_010393] [NC_000016] [References] [Notes] (SE = -.9)
GGGTACTTTCATTGAATTCCGAAATGGGATGTTAAACGTGTCCCCTATTGGAAGAAGCTGCAGCCAAGAAGAACGCATTGAGTTCTACGAACTCGATAAA

GGGTACTTTCATTGAATTCCGAAATGGGATGTTAAACGTGTCCCCTATTGGAAGAAGCTGCAGCCAAAAAGAACGCATTGAGTTCTACGAACTCGATAAA
8[EXON_11] [EID ID: 5718_NT_006713] [NC_000005.8] [References] [Notes] (SE = -.15)
CTTGCGCCGGGCACAATAGTTGAAGTATGGAAAGACAGCGCATATCCTGAGGAACTCAGTAGAGTCACAGCATCTGGCTTCCCTGTAATCCTTTCTGCTC
CTTGGTACTTAGATTTGATTAGCTATGGACAAGATTGGAGGAAATACTATAAAGTGGAACCTCTTGATTTTGGCG

CTTGCGCTGGGCACAATAGTTGAAGTATGGAAAGACAGCGCATATCCTGAGGAACTCAGTAGAGTCACAGCATCTGGCTTCCCTGTAATCCTTTCTGCTC
CTTGGTACTTAGATTTGATTAGCTATGGACAAGATTGGAGGAAATACTATAAAGTGGAACCTCTTGATTTTGGCG
9[EXON_20] [EID ID: 19925_NT_011651] [NM_000052] [References] [Notes] (SE = -.5)
GTTGGCATTACTAAGGTGTTTGCTGAAGTTCTACCTTCTCACAAGGTTGCTAAAGTGAAGCAACTTCAAGAGGAGGGGAAACGGGTAGCAATGGTGGGAG
ATGGAATCAATGACTCCCCAGCTCTGGCAATGGCTAATGTGGGAATTGCTATTGGCACAGGCACAGATGTAGCCATTGAAGCAGCTGATGTGGTTTTGAT
AAGG

GTTGGCATTACTAAGGTGTTTGCTGAAGTTCTACCTTCTCACAAGGTTGCTAAAGTGAAGCAACTTCAAGAGGAGGGGAAACGGGTAGCAATGGTGGGAG
ATAGAATCAATGACTCCCCAGCTCTGGCAATGGCTAATGTGGGAATTGCTATTGGCACAGGCACAGATGTAGCCATTGAAGCAGCTGATGTGGTTTTGAT
AAGG
10[EXON_14] [EID ID: 16151A_NT_010755] [NM_007296] [References] [Notes] (SE = -1)
ATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT

ATGCTTAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT
12[EXON_19] [EID ID: 20244B_NT_025307] [NM_000132] [References] [Notes] (SE = -1)
GTGTTTTTGAGACAGTGGAAATGTTACCATCCAAAGCTGGAATTTGGCGGGTGGAATGCCTTATTGGCGAGCATCTACATGCTGGGATGAGCACACTTTT
TCTGGTGTACAGCAATA

GTGTTTTTGAGACAGTGGAAATGTTACCATCCAAAGCTGGAATTTGGTGGGTGGAATGCCTTATTGGCGAGCATCTACATGCTGGGATGAGCACACTTTT
TCTGGTGTACAGCAATA
13[EXON_2] [EID ID: 20103_NT_011786] [NC_000023.9] [References] [Notes] (SE = -1)
ATTAGTGATGATGAACCAGGTTATGACCTTGATTTATTTTGCATACCTAATCATTATGCTGAGGATTTGGAAAGGGTGTTTATTCCTCATGGACTAATTA
TGGACAG

ATTAGTGATGATGAACCAGGTTATGACCTTGATTTATTTTGCATACCTAATCATTATGCTGAGGATTTGGAAAGGGTGTTTATTCCTCATGTACTAATTA
TGGACAG
14[EXON_3] [EID ID: 20103_NT_011786] [NC_000023.9] [References] [Notes] (SE = -1)
GACTGAACGTCTTGCTCGAGATGTGATGAAGGAGATGGGAGGCCATCACATTGTAGCCCTCTGTGTGCTCAAGGGGGGCTATAAATTCTTTGCTGACCTG
CTGGATTACATCAAAGCACTGAATAGAAATAGTGATAGATCCATTCCTATGACTGTAGATTTTATCAGACTGAAGAGCTATTGT

GACTGAACATCTTGCTCGAGATGTGATGAAGGAGATGGGAGGCCATCACATTGTAGCCCTCTGTGTGCTCAAGGGGGGCTATAAATTCTTTGCTGACCTG
CTGGATTACATCAAAGCACTGAATAGAAATAGTGATAGATCCATTCCTATGACTGTAGATTTTATCAGACTGAAGAGCTATTGT
15[EXON_6] [EID ID: 20103_NT_011786] [NC_000023.9] [References] [Notes] (SE = -1)
GATATAATTGACACTGGCAAAACAATGCAGACTTTGCTTTCCTTGGTCAGGCAGTATAATCCAAAGATGGTCAAGGTCGCAAG

GATATAATTGACACTGGCAAAACAATGCAGACTTTGCTTTCCTTGGTCAGGCAGTATAATCCAAAGATGGTCAAGGTCGAAAG
16[EXON_8] [EID ID: 20103_NT_011786] [NC_000023] [References] [Notes] (SE = -.77)
TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT

TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTTACTATAATGAATACTTCAGGGATTTGAAT
17[EXON_8] [EID ID: 20103_NT_011786] [NC_000023] [References] [Notes] (SE = -.77)
TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT

TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTTAGGGATTTGAAT
18[EXON_10] [EID ID: 8057_NT_007933] [AY608405] [References] [Notes] (SE = -1)
GGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTG
GTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAG

GGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTG
GTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGAAGCAGGCAAG
19[EXON_13] [EID ID: 8057_NT_007933] [AY608405] [References] [Notes] (SE = -1)
AGCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATATTTGAAAG

AGCAGTATACAAAGGTGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATATTTGAAAG
20[EXON_8] [EID ID: 20103_NT_011786] [NC_000023.9] [References] [Notes] (SE = -.5)
TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT

TTGTTAGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT
21[EXON_8] [EID ID: 20103_NT_011786] [NC_000023.9] [References] [Notes] (SE = -1)
TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT

TTGTTGTATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT
22[EXON_8] [EID ID: 20103_NT_011786] [NC_000023.9] [References] [Notes] (SE = -.05)
TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT

TTGTTGGATTTAAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT
23[EXON_2] [EID ID: 14101_NT_010194] [NM_002225.2] [References] [Notes] (SE = -1)
CTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGA

CTTTGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGA
24[EXON_2] [EID ID: 14101_NT_010194] [NM_002225.2] [References] [Notes] (SE = -1)
CTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGA

CTTCCTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGA
25[EXON_2] [EID ID: 14101_NT_010194] [NM_002225.2] [References] [Notes] (SE = -1)
CTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGA

CTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCAATCGCAGCAATGAGTTCAAGAACCTGCGA
26[EXON_8] [EID ID: 14101_NT_010194] [NM_002225.2] [References] [Notes] (SE = -.48)
CTGCCAACATCCTGGGCCATGAGAATAAGGGTGTCTACGTGCTGATGAGTGGGCTGGACCTGGAGCGGCTGGTGCTGGCCGGGGG_GCCTCTTGG

CTGCCAACATCCTGGGCCATGAGAATAAGGGTGTCTACGTGCTGATGAGTGGGCTGGACCTGGAGCGGCTGGTGCTGGCCGGGGGGGCCTCTTGG
27[EXON_11] [EID ID: 16210A_NT_010783] [NM_016835] [References] [Notes] (SE = +.4)
GTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGT

GTGCAGATAATTAAGAAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGT
28[EXON_17] [EID ID: 3717_NT_022517] [NM_000249] [References] [Notes] (SE = -.3)
GAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCCACTGAG

GAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCCACTAGCCACTGAG
29[EXON_8] [EID ID: 20103_NT_011786] [NM_000194] [References] [Notes] (SE = -.4)
TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT

TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATTAATACTTCAGGGATTTGAAT
30[EXON_8] [EID ID: 20103_NT_011786] [NM_000194] [References] [Notes] (SE = -.74)
TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT

TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGTATACTTCAGGGATTTGAAT
31[EXON_8] [EID ID: 20103_NT_011786] [NM_000194] [References] [Notes] (SE = -X)
TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAAT

TTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGTTTTGAAT
32[EXON_11] [EID ID: 16210A_NT_010783] [NM_016835] [References] [Notes] (SE = +.25)
GTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGT

GTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAACATCAAACACGTCCCGGGAGGCGGCAGT
33[EXON_11] [EID ID: 12602_NT_019546] [NM_000277] [References] [Notes] (SE = -.7)
TACTGCTTATCAGAGAAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCACGGAGTTCCAGCCCCTCTATTACGTGG
CAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAG

TACTGCTTATCAGAGAAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCACGGAGTTCCAGCCCCTCTATTACGTGG
CAGAGAGTTTTAATGATGCCAAGGAGAAAGTTAG
34[EXON_4] [EID ID: 1720A_NT_004487] [NM_002838] [References] [Notes] (SE = +.7)
GATTGACTACAGCAAAGATGCCCAGTGTTCCACTTTCAAGTGACCCCTTACCTACTCACACCACTGCATTCTCACCCGCAAGCACCTTTGAAAGAGAAAA
TGACTTCTCAGAGACCACAACTTCTCTTAGTCCAGACAATACTTCCACCCAAGTATCCCCGGACTCTTTGGATAATGCTAGTGCTTTTAATACCACAG

GATTGACTACAGCAAAGATGCCCAGTGTTCCACTTTCAAGTGACCCCTTACCTACTCACACCACTGCATTCTCACCGGCAAGCACCTTTGAAAGAGAAAA
TGACTTCTCAGAGACCACAACTTCTCTTAGTCCAGACAATACTTCCACCCAAGTATCCCCGGACTCTTTGGATAATGCTAGTGCTTTTAATACCACAG
35[EXON_8] [EID ID: 11619A_NT_033899] [NM_000051] [References] [Notes] (SE = -1)
ACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTCAAGACTTTGGCTGTCAACTTTCGAATTCGAGTGTGTGAATTA
GGAGATGAAATTCTTCCCACTTTGCTTTATATTTGGACTCAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATTGAATTATTTCAACTGCAAATTT
ATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAAG

ACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTCAAGACTTTGGCTGTCAACTTTCGAATTTGAGTGTGTGAATTA
GGAGATGAAATTCTTCCCACTTTGCTTTATATTTGGACTCAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATTGAATTATTTCAACTGCAAATTT
ATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAAG
36[EXON_8] [EID ID: 11619A_NT_033899] [NM_000051] [References] [Notes] (SE = -1)
ACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTCAAGACTTTGGCTGTCAACTTTCGAATTCGAGTGTGTGAATTA
GGAGATGAAATTCTTCCCACTTTGCTTTATATTTGGACTCAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATTGAATTATTTCAACTGCAAATTT
ATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAAG

ACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTCAAGACTTTGGCTGTCAACTTTCGAATTCGAGTGTGTGAATTA
GGAGATGAAATTCTTCCCACTTTGCTTTATATTTGGACTTAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATTGAATTATTTCAACTGCAAATTT
ATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAAG
37[EXON_41] [EID ID: 11619A_NT_033899] [NM_000051] [References] [Notes] (SE = -.3)
AAGTCTTGCATTTGAAGAAGGAAGCCAGAATACAACTATTTCTAGCTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGTTTACAG

AAGTCTTGCATTTTAAGAAGGAAGCCAGAATACAACTATTTCTAGCTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGTTTACAG
38[EXON_41] [EID ID: 11619A_NT_033899] [NM_000051] [References] [Notes] (SE = -X)
AAGTCTTGCATTTGAAGAAGGAAGCCAGAATACAACTATTTCTAGCTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGTTTACAG

AAGTCTTGCATTTGAAGAAGGAAGCCAGAATACAACTATTTCTAGCTTGAGTTAAAAAAGTAAAGAAGAAACTGGAATAAGTTTACAG
39[EXON_14] [EID ID: 5852_NT_034772] [NM_000038] [References] [Notes] (SE = -.7)
GAATCAACCCTCAAAAGCGTATTGAGTGCCTTATGGAATTTGTCAGCACATTGCACTGAGAATAAAGCTGATATATGTGCTGTAGATGGTGCACTTGCAT
TTTTGGTTGGCACTCTTACTTACCGGAGCCAGACAAACACTTTAGCCATTATTGAAAGTGGAGGTGGGATATTACGGAATGTGTCCAGCTTGATAGCTAC
AAATGAGGACCACAG

GAATCAACCCTCAAAAGCGTATTGAGTGCCTTATGGAATTTGTCAGCACATTGCACTGAGAATAAAGCTGATATATGTGCTGTAGATGGTGCACTTGCAT
TTTTGGTTGGCACTCTTACTTACCGTAGCCAGACAAACACTTTAGCCATTATTGAAAGTGGAGGTGGGATATTACGGAATGTGTCCAGCTTGATAGCTAC
AAATGAGGACCACAG
40[EXON_17] [EID ID: 3717_NT_022517] [NM_000249] [References] [Notes] (SE = -.3)
GAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCCACTGAG

GAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCTACTAGCCACTGAG
41[EXON_17] [EID ID: 3717_NT_022517] [NM_000249] [References] [Notes] (SE = -.3)
GAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCCACTGAG

GAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTTGACTAGCCACTGAG
42[EXON_8] [EID ID: 14472_NT_010194] [NM_000137] [References] [Notes] (SE = -X)
GCTTTTTTTGTAGGCCCTGGAAACAGATTGGGAGAGCCGATCCCCATTTCCAAGGCCCATGAGCACATTTTTGGAATGGTCCTTATGAACGACTGGAGTG

GCTTTTTTTGTAGGCCCTGGAAACAGATTGGGAGAGCCGATCCCCATTTCCAAGGCCCATGAGCACATTTTTGGAATGGTCCTTATGAATGACTGGAGTG
43[EXON_2] [EID ID: 11723_NT_033899] [NM_000190] [References] [Notes] (SE = -X)
GAAGAAAACAGCCCAAAGATGAGAGTGATTCGCGTGGGTACCCGCAAGAGCCAG

GAAGAAAACAGCCCAAAGATGAGAGTGATTCGGGTGGGTACCCGCAAGAGCCAG
44[EXON_11] [EID ID: 10114A_NT_033985] [NM_020975] [References] [Notes] (SE = -1)
ATCCACTGTGCGACGAGCTGTGCCGCACGGTGATCGCAGCCGCTGTCCTCTTCTCCTTCATCGTCTCGGTGCTGCTGTCTGCCTTCTGCATCCACTGCTA
CCACAAGTTTGCCCACAAGCCACCCATCTCCTCAGCTGAGATGACCTTCCGGAGGCCCGCCCAGGCCTTCCCGGTCAGCTACTCCTCTTCCGGTGCCCGC
CGGCCCTCGCTGGACTCCATGGAGAACCAGGTCTCCGTGGATGCCTTCAAGATCCTG

ATCCACTGTGCGACGAGCTGTGCCGCACGGTGATCGCAGCCGCTGTCCTCTTCTCCTTCATTGTCTCGGTGCTGCTGTCTGCCTTCTGCATCCACTGCTA
CCACAAGTTTGCCCACAAGCCACCCATCTCCTCAGCTGAGATGACCTTCCGGAGGCCCGCCCAGGCCTTCCCGGTCAGCTACTCCTCTTCCGGTGCCCGC
CGGCCCTCGCTGGACTCCATGGAGAACCAGGTCTCCGTGGATGCCTTCAAGATCCTG
45[EXON_9] [EID ID: 15929_NT_010799] [NC_000017.9] [References] [Notes] (SE = -.25)
AAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAG
CAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAG

AAGTTATTTCTGGACAGTCTATGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAG
CAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAG
46[EXON_9] [EID ID: 15929_NT_010799] [NC_000017.9] [References] [Notes] (SE = -.5)
AAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAG
CAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAG

AAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAACTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAG
CAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAG
47[EXON_9] [EID ID: 15929_NT_010799] [NC_000017.9] [References] [Notes] (SE = -.5)
AAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAG
CAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAG

AAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGATGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAG
CAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAG
48[EXON_17] [EID ID: 3717_NT_022517] [NM_000249] [References] [Notes] (SE = -X)
GAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCCACTGAG

GAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTT__ACTAGCCACTGAG
49[EXON_51] [EID ID: 14205_NT_010194] [NM_000138.2] [References] [Notes] (SE = -1)
AGGCCTTCCGCCAGATATGTCCTTATGGAAGTGGGATCATCGTGGGACCTGATGATTCAGCAGTTG

AGGCCTTCCGCCAGATATGTCCTTATGGAAGTGGGATCATTGTGGGACCTGATGATTCAGCAGTTG
50[EXON_6] [EID ID: 19633_NT_011757] [NM_000284.1] [References] [Notes] (SE = -.65)
GTGCCCCTGGGCGCTGGGATTGCTCTAGCCTGTAAGTATAATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAACCAG

GTGCCCCTGGGCGCTGGGATTGCTCTAGCCTGTAAGTATAATGGGAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAACCAG
51[EXON_6] [EID ID: 19633_NT_011757] [NM_000284.1] [References] [Notes] (SE = -1)
GTGCCCCTGGGCGCTGGGATTGCTCTAGCCTGTAAGTATAATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAACCAG

GTGCCCCTGGGCACTGGGATTGCTCTAGCCTGTAAGTATAATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAACCAG

Top v1.0