ALT SPL MUT DB

Alternative Splicing Mutation Database

Bechtel J M, Rajesh P, Ilikchyan I, Deng Y, Mishra P K, Wang Q, Wu X, Afonin K, Grose W E, Wang Y, Khuder S, and Fedorov A
NOTE: This is the final 1.0 release of the ASMD. All substitution mutations now have a note describing the codon change involved, based on the exon phase according to the EID. Entry 11 was found to describe a substitution in the last position of its exon (so, in a splicing junction) and had to be removed. A deposition form will be forthcoming.
NOTE: Later releases of the ASMD are now available by following this link. It has a much improved interface, many more entries, a true relational database back-end, and a public deposition form. This site is preserved for now, but may disappear in the future. The link to the more permanent home for the 1.0 release is http://mco321125.meduohio.edu/~jbechtel/asmd/1.0/. Please update any bookmarks to reflect the new location.


Exon Info for ASMD Entry #25   [References]   [Notes]
Exon #:2
Exon length:90
Exon phase(s):0-0
Gene info:EID ID: 14101_NT_010194
Wildtype sequence:
CTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGA
Mutation position:61/90
Codon change:missense mutation [GAT (Asp) -> AAT (Asn)]
Base composition:A - 26%
C - 31%
G - 26%
T - 18%

Top v1.0